| High - quality plasmid sequencing with ThermoFidelase
Fidelity Systems routinely uses ThermoFidelase technology for plasmid sequencing. ThermoFidelase unlinks and denatures plasmid DNA templates and makes them available for primer annealing.
How ThermoFidelase works on a plasmid:
Addition of ThermoFidelase proprietary mixtures to the sequencing reactions improves both the intensity of the signals and the quality of base calling procedure. As a result, more reliable sequencing data are obtained. We also show here examples of dye-primer plasmid sequencing, as they eliminate biases of dye-terminator chemistry.
Automatic one pass dye-primer plasmid DNA sequencing with Bca DNA polymerase. Sequence chromatograms of pUC plasmid denatured with alkali vs unlinked and denatured by ThermoFidelase.
Automatic dye-primer plasmid DNA sequencing with Taq DNA polymerase. Effects of ThermoFidelase addition.
-TF cgnt-actgactcgctgcgctcggtcg-tcggctgc-gcgagcggnatca-ctcactc-aangcgg-aatacgg-tattcacagaatcangggat-ac || | |||||||||||||||||||||| |||||||| |||||||| |||| ||||||| || |||| ||||||| |||||||||||||| ||||| || +TF cgctcactgactcgctgcgctcggtcgttcggctgcggcgagcggtatcagctcactcaaaggcggtaatacggttatccacagaatcaggggataac |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Cloning cgctcactgactcgctgcgctcggtcgttcggctgcggcgagcggtatcagctcactcaaaggcggtaatacggttatccacagaatcaggggataac vector pGEM-3Zf(+) gi 5531232 Effects of ThermoFidelase addition on automatic BigDye Terminator plasmid DNA sequencing.
Covered by U.S. Patents 5,427,928, 5,656,463, 5,902,879, 6,548,251. Patents pending. Fidelase, ThermoFidelase, D-Strap and Fimer are trademarks of Fidelity Systems. |